ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C__26457248_10SI001443MAlcohol Dehydrogenase 4 (class II), pi polypeptide ADH4
FstAvg Het# Populations Typed
0.1510.36255
Synonyms: rs1800760 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C__26457248_10 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This A/T SNP is located in the promoter region of ADH4 gene.

Note: The alleles A & T and the flanking sequence in the 'Allele Description" represents the reverse strand and is the opposite strand from dbSNP. The data linked to "Kidd Lab Unpublished" were typed on the reverse strand and that of Kimura et.al, 2009 is on the forward strand. All data have been entered to be consistent with the typing of the reverse strand.
Alleles:
Allele NameAllele SymbolDescription
AA5' - tgagctccaagattttttaa A ttcttttttcttttattgaaaaa - 3'
TT5' - tgagctccaagattttttaa T ttcttttttcttttattgaaaaa - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

- Kimura Y, Nishimura FT, Abe S, Fukunaga T, Tanii H, Saijoh K "Polymorphisms in the promoter region of the human class II alcohol dehydrogenase (ADH4) gene affect both transcriptional activity and ethanol metabolism in Japanese subjects". J Toxicol Sci. 34:89-97. (2009) Online citation.


© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan