ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C__11941798_30SI001448RAlcohol Dehydrogenase 4 (class II), pi polypeptide ADH4
FstAvg Het# Populations Typed
0.1280.189117
Synonyms: rs1126672 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C__11941798_30 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is a C/T SNP which results in synonymous substitution Leucine (CTG) -> Leucine (TTG) at aminoacid position 351 of coding region of ADH4 gene.
Alleles:
Allele NameAllele SymbolDescription
CC5' - agaaattcaatctggatgca CTG gtgacccataccctgcct - 3'
TT5' - agaaattcaatctggatgca TTG gtgacccataccctgcct - 3'

References:

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan