ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
C___9523707_30SI001450KAlcohol Dehydrogenase 4 (class II), pi polypeptide ADH4
FstAvg Het# Populations Typed
0.1290.19117
Synonyms: rs1042364 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C___9523707_30 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is a A/G SNP which results in non-synonymous substitution Arginine (AGA) -> Glycine (GGA) at aminoacid position 388 of coding region of ADH4 gene.
Alleles:
Allele NameAllele SymbolDescription
AA5' - gaagatgccaggagcaattc AGA atactatctgattgaatg - 3'
GG5' - gaagatgccaggagcaattc GGA atactatctgattgaatg - 3'

References:

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan