ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
G/A SNP (Gly180Arg)SI001630KATP-binding cassette, sub-family C (CFTR/MRP), member 11ABCC11
FstAvg Het# Populations Typed
Synonyms: C__25999969_20 ; rs17822931 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a G/A SNP in the coding region of ABCC11 gene. This SNP results in non-synonymous change Glycine(GGG) -> Arginine(AGG) at aminoacid position 180 of the gene.

This SNP determines the earwax type (PMID: 16444273). According to their study dry earwax is frequent in East Asians, whereas wet earwax is common in other populations. Allele A is associated with dry earwax type. This SNP is the first example of DNA polymorphism determing a visible genetic trait.

C__25999969_20 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This assay types the reverse strand and the corresponding alleles are G and A respectively. The alleles on the forward strand are C and T.

Allele NameAllele SymbolDescription
CC5' - ctcaccaagtctgccacttactggcc C gagtacactggcaatgcag - 3'
TT5' - ctcaccaagtctgccacttactggcc T gagtacactggcaatgcag - 3'

- Yoshiura KI et al. "A SNP in the ABCC11 gene is the determinant of human earwax type.". Nat Genet. 38:324-330. (2006)
Online citation.

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan