ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
E_rs1587264_10SI001677Vuncharacterized LOC100507053LOC100507053
Previously associated with :  ADH1B
FstAvg Het# Populations Typed
Synonyms: rs1587264 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  E_rs1587264_10 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is a A/G SNP in the intergenic region of ADH1B-1A genes.

Note:This taqman assay types the other strand and the corresponding alleles are T and C respectively.
Ancestral Allele:  A
Allele NameAllele SymbolDescription
AA5' - attagaaatgaaatgggaa A aattacaaccaataccacaa - 3'
GG5' - attagaaatgaaatgggaa G aattacaaccaataccacaa - 3'

- Han Y, Oota H, Sheng Gu, Osier M, Pakstis AJ, Speed WC, Kidd JR, Kidd KK "Evidence of Positive Selection on a Class I ADH Locus". American Journal of Human Genetics 80:441-56. (2007)
Online citation.

© 2018 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan