ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Glu272LysSI003961TSolute carrier family 45, member 2SLC45A2
FstAvg Het# Populations Typed
0.2160.24979
Synonyms: rs26722 ; E272K ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a T/C SNP in the exon 3 of SLC45A2 gene. This SNP results in non-synonymous substitution Glutamic acid (GAG) -> Lysine (AAG) at aminoacid poisition 272 of the gene.
Alleles:
Allele NameAllele SymbolDescription
GluC5' - cgtaaccatttttaactttct Cgatagaaccatactcgtacat - 3'
LysT5' - cgtaaccatttttaactttct Tgatagaaccatactcgtacat - 3'

References:
- Yuasa I, Umetsu K, Watanabe G, Nakamura H, Endoh M, Irizawa Y. "MATP polymorphisms in Germans and Japanese: the L374F mutation as a population marker for Caucasoids". Int J Legal Med. 118:364-366. (2004)
Online citation.


© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan