ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.

00ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
Thr329Thr	SI003962U	Solute carrier family 45, member 2	SLC45A2

Fst	Avg Het	# Populations Typed
0.127	0.186	2

Synonyms: rs2287949 ; T329T ;
Frequency Display Formats:

Estimated Heterozygosity:

External Resources: dbSNP rs # Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is A/G SNP in exon 4 of SLC45A2 gene. This SNP results in synonymous substitution Threonine (ACA) -> Threonine (ACG) at aminoacid position 329 of the gene.
Ancestral Allele: C
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - agccacctcattggatgg ACA gccttcctgtccaacatgct � 3'
G	G	5' - agccacctcattggatgg ACG gccttcctgtccaacatgct � 3'

References:
- Yuasa I, Umetsu K, Watanabe G, Nakamura H, Endoh M, Irizawa Y. "MATP polymorphisms in Germans and Japanese: the L374F mutation as a population marker for Caucasoids". Int J Legal Med. 118:364-366. (2004) Online citation.

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan