ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Val507LeuSI003964WSolute carrier family 45, member 2SLC45A2
FstAvg Het# Populations Typed
0.0030.0052
Synonyms: V507L ; rs3733808 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/G SNP in exon 7 of the SLC45A2 gene. This SNP results in non-synonymous substitution Valine (GTG) -> Leucine (CTG) at aminoacid 507 of the gene.
Ancestral Allele:  G
Alleles:
Allele NameAllele SymbolDescription
LeuC5' - cagccgggaccgttgtcgtc CTG gtgatcacagcgtctgcg 3'
ValG5' - cagccgggaccgttgtcgtc GTG gtgatcacagcgtctgcg 3'

References:

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan