ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs1800761SI015502NAlcohol Dehydrogenase 4 (class II), pi polypeptide ADH4
FstAvg Het# Populations Typed
00.381
Synonyms: rs1800761 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This SNP is in the promoter region of ADH4 gene. This SNP is reported as 'Mixed' under 'Variation class' in dbSNP with submissions from 2 or more alleleic classes. The reported alleles in dbSNP are A/G/T. The alleles in Kimura et.al,2009 are A & G.
Alleles:
Allele NameAllele SymbolDescription
AA5'- ttggagctcactgggagcaatg A ggtttgcagctgaagtccaata -3'
GG5'- ttggagctcactgggagcaatg G ggtttgcagctgaagtccaata -3'

References:
- Kimura Y, Nishimura FT, Abe S, Fukunaga T, Tanii H, Saijoh K "Polymorphisms in the promoter region of the human class II alcohol dehydrogenase (ADH4) gene affect both transcriptional activity and ethanol metabolism in Japanese subjects". J Toxicol Sci. 34:89-97. (2009)
Online citation.


© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan