ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs2001142SI292126WCalmodulin binding transcription activator 1CAMTA1
FstAvg Het# Populations Typed
0.0710.277116
Synonyms: rs2001142 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a C/T SNP
Alleles:
Allele NameAllele SymbolDescription
CC5' - agtctattagtctgttcttg C attactacagagaaatgcct - 3'
TT5' - agtctattagtctgttcttg T attactacagagaaatgcct - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".


© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan