ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.

00ALFRED detailed record information

Name	ALFRED UID	Locus Name	Locus Symbol
rs3737656	SI384692G	ethanolamine kinase 2	ETNK2

Fst	Avg Het	# Populations Typed
0.118	0.203	114

Synonyms: rs3737656 ;
Frequency Display Formats:

Estimated Heterozygosity:

External Resources: dbSNP rs# Record PharmGKB Variant Information Record
References: See References
Polymorphism Description: This is a A/G SNP
Alleles:

Allele Name	Allele Symbol	Description
A	A	5' - agagggagtgatgaggctca A attcagggctcttgaggcca - 3'
G	G	5' - agagggagtgatgaggctca G attcagggctcttgaggcca - 3'

References:
- Kenneth K. Kidd et al. "Data unpublished".

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan