ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Val370AlaSI663326AEctodysplasin A receptorEDAR
FstAvg Het# Populations Typed
Synonyms: rs3827760 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/G SNP in the coding region of EDAR gene. This SNP results in non-synonymous substitution Valine (GTT) -> Alanine (GCT) at aminoacid position 370 of the gene.

The 1540C allele of this polymorphism has been reported to be associated with Asian-specific hair thickness (Fujimoto A etal). According to their study the derived allele, 1540C, increased in frequency in Asian populations by recent positive selection.

Note: The alleles and the flanking sequence are those on the forward strand and the gene is on the reverse strand.

Allele NameAllele SymbolDescription
AA5'- aggtggcgccacgttttcac AAC agccttctcagagttgtacgtgga -3'
GG5'- aggtggcgccacgttttcac AGC agccttctcagagttgtacgtgga -3'

- Bryk J, Hardouin E, Pugach I, Hughes D, Strotmann R, Stoneking M, Myles S "Positive selection in East Asians for an EDAR allele that enhances NF-kappaB activation". Plos One 3:e2209. (2008)
Online citation.

- Fujimoto A, Kimura R, Ohashi J, Omi K, Yuliwulandari R, Batubara L, Mustofa MS, Samakkarn U, Settheetham-Ishida W, Ishida T, Morishita Y, Furusawa T, Nakazawa M, Ohtsuka R, Tokunaga K. "A scan for genetic determinants of human hair morphology: EDAR is associated with Asian hair thickness". Hum Mol Genet. 17:835-43. (2008) Online citation.

© 2018 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan