ALFRED: allele frequency database

The ALlele FREquency Database
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.

00ALFRED detailed record information

Polymorphism Information

Name	ALFRED UID	Locus Name	Locus Symbol
rs2296797	SI664252Z	component of oligomeric golgi complex 2	COG2

Fst	Avg Het	# Populations Typed
0.227	0.372	74

Synonyms: rs2296797 ;
Frequency Display Formats:

Estimated Heterozygosity:

External Resources: dbSNP rs# Record
References: See References
Polymorphism Description: This is a G/T SNP in the intron region of COG2 gene.
Alleles:

Allele Name	Allele Symbol	Description
G	G	5'-atgtttatccaaacacctgg G agatagtgtcatgtaaaatt -3'
T	T	5'-atgtttatccaaacacctgg T agatagtgtcatgtaaaatt -3'

References:
- Kidd, K.K., Pakstis, A.J., Speed, W.C., Lagace, R., Chang, J., Wootton, S.,Ihuegbu, N. "Microhaplotype loci are a powerful new type of forensic marker". Forensic Science International: Genetics supplement series 4:e123-124. (2013)

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan