ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs150209521SI664507CTaste receptor, type 2, member 38 TAS2R38
Synonyms: rs150209521 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: 
References: See References
Polymorphism Description:  This is a C/T SNP in the coding region of TAS2R38 gene.
Alleles:
Allele NameAllele SymbolDescription
CC5' - gtggttcactcaacttctggaag C gggtaagctggatagcactcagga- 3'
TT5' - gtggttcactcaacttctggaag T gggtaagctggatagcactcagga- 3'

References:

© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan