ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the Yale Center for Medical Informatics.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs2278007SI664753FSolute carrier family 45, member 2SLC45A2
FstAvg Het# Populations Typed
0.1190.18578
Synonyms: rs2278007 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs# Record  
References: See References
Polymorphism Description:  This is a A/G SNP in the intron region of SLC45A2 gene.
Alleles:
Allele NameAllele SymbolDescription
AA5' gtttttcctgacgtccatagatttatt A agaatctggtattttaaacagtaggaaa - 3'
GG5' gtttttcctgacgtccatagatttatt G agaatctggtattttaaacagtaggaaa - 3'

References:
- Brissenden JE, Kidd JR, Evsanaa B, Togtokh A, Pakstis AJ, Friedlaender F, Kidd KK, Roscoe J "Mongolians in the genetic landscape of central Asia: exploring the genetic relations among Mongolians and other world populations.". Human Biology 87:73-91. (2015)
Online citation.


© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan