ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
FstAvg Het# Populations Typed
Synonyms: rs10186843 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs # Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  C___2140125_10 is an ABI Assays-on-DemandTM SNP Genotyping Assay ID. This is A/C SNP located in the intron region of the gene LCT.
Allele NameAllele SymbolDescription
AA5' - gtaaatattcaccttaacaagctaa A ccttgtatcccttctaggaa - 3'
CC5' - gtaaatattcaccttaacaagctaa C ccttgtatcccttctaggaa - 3'


© 2018 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan