ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
Ala111ThrSI007419VSolute carrier family 24, member 5SLC24A5
FstAvg Het# Populations Typed
Synonyms: rs1426654 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
Frequency Download:   
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/G SNP in the coding region of SLC24A5 gene. This SNP results in non-synonymous substitution Alanine(GCA) -> Threonine(ACA) at aminoacid position 111 of the gene. The derived allele (T= Thr) has been associated with light skin pigmentation in Europe and is common in Europe, Southwest Asia, and Central Asia. This SNP has shown evidence of natural selection. This SNP is commonly included in panels of ancestry informative SNPs and in phenotype informative markers.
Ancestral Allele:  G
Allele NameAllele SymbolDescription
AA5'- tgtctcaggatgttgcaggc ACA actttcatggcagcgggc - 3'
GG5'- tgtctcaggatgttgcaggc GCA actttcatggcagcgggc - 3'

- Phillips C, Salas A, Sánchez JJ, Fondevila M, Gómez-Tato A, Álvarez-Dios J, Calaza M, Casares de Cal M , Ballard D, Lareu MV, Carracedo A - The SNPforID Consortium "Inferring ancestral origin using a single multiplex assay of ancestry-informative marker SNPs". Forensic Science International: Genetics 1:273-280. (2007)
Online citation.

© 2017 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan