ALFRED: allele frequency database
      The ALlele FREquency Database   
ALFRED is a resource of gene frequency data on human populations
supported by the U. S. National Science Foundation.
00ALFRED detailed record information

Polymorphism Information

NameALFRED UIDLocus NameLocus Symbol
rs12913832SI007119SHect domain and RLD 2HERC2
FstAvg Het# Populations Typed
0.4430.169180
Synonyms: rs12913832 ; C__30724404_10 ;
Frequency Display Formats:     
Estimated Heterozygosity: 
External Resources: dbSNP rs# Record  PharmGKB Variant Information Record  
References: See References
Polymorphism Description:  This is a A/G SNP in an intronic region of the HERC2 gene and just upstream of OCA2. The derived G allele of this SNP is common only in Europeans particularly those of Northwestern and Eastern European descent. This G allele of this SNP has been associated with the blue iris phenotype. This SNP is commonly included in panels of ancestry informative SNPs and in phenotype informative markers.
Ancestral Allele:  A
Alleles:
Allele NameAllele SymbolDescription
AA5' - cagtttcatttgagcattaa A tgtcaagttctgcacgctat - 3'
GG5' - cagtttcatttgagcattaa G tgtcaagttctgcacgctat - 3'

References:
- Phillips C, Salas A, Sánchez JJ, Fondevila M, Gómez-Tato A, Álvarez-Dios J, Calaza M, Casares de Cal M , Ballard D, Lareu MV, Carracedo A - The SNPforID Consortium "Inferring ancestral origin using a single multiplex assay of ancestry-informative marker SNPs". Forensic Science International: Genetics 1:273-280. (2007)
Online citation.


© 2019 Kenneth K Kidd, Yale University. All rights reserved. The full Copyright Notification is also available.
Originally prototyped by Michael Osier with the aid of Kei Cheung
Upgrades and maintenance since 2002 by Haseena Rajeevan